Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

Article Title: Epigenetic Control of Translation Checkpoint and Tumor Progression via RUVBL1-EEF1A1 Axis.

doi: 10.1002/advs.202206584

Figure Lengend Snippet: Figure 2. RUVBL1 controls MYC chromatin localization and transactivation activity in EwS. A) RNAseq and GSEA analyses showing changes in expression of the MYC upregulated target gene set in sgCtrl and sgRUVBL1 transduced (day 5) A673-Cas9 cells (two independent sgRNA sequences per group). (Right) Each dot indicates one gene set from the GSEA Molecular Signature Database (MSigDB; total 238 gene sets from the Hallmark and Oncogenic Signature [C6] collections). NES: Normalized enrichment score. B) Growth competition assay of sgCtrl (gray lines; n = 2 independent sgRNA sequences) and sgMYC (purple lines; n = 5 independent sgRNA sequences) in A673-Cas9 cells. C) Cell cycle monitored by EdU incorporation, and D) cellular apoptosis detected by active caspase 3+/DAPI−in A673-Cas9 cells transduced with sgCtrl and sgMYC (n = 3 for each group). E) Western blot of RUVBL1, MYC, histone H4, and GAPDH in A673-Cas9 cells transduced with sgCtrl and sgRUVBL1 (two independent sgRNA sequences per group). F) Co-IP of RUVBL1 (flag-tagged) with RUVBL2 and MYC in HEK293 cells. G) Meta plots (top) and heatmaps (bottom) showing ChIP-seq signal of MYC at TSSs ± 3 kb regions for all genes in A673-Cas9 cells transduced with sgCtrl and sgRUVBL1. H) Profiles of MYC ChIP-seq and (I) ChIP-qPCR at RUVBL1 locus in A673-Cas9 cells transduced with sgCtrl and sgRUVBL1 (n = 3 for each group). J) RT-qPCR of RUVBL1 mRNA in A673-Cas9 cells transduced with sgCtrl and sgMYC (n = 3 for each group). K) Western blot of MYC, RUVBL1, and GAPDH in A673-Cas9 cells transduced with sgMYC (two independent sgRNA sequences per group). L) Model of a feed-forward network between RUVBL1 and MYC in EwS. Data are represented as mean ± SEM. *P < 0.01 compared to sgCtrl by two-sided Student’s t-test.

Article Snippet: PVDF membranes were immersed in 5% nonfat milk then incubated at 4 °C overnight with primary antibodies against RUVBL1 (HPA019947, Sigma; 1:1000), RUVBL2 (12668S, Cell Signaling Technology; 1:1000), MYC (13987S, Cell Signaling Technology; 1:1000), EEF1A1 (PA5-17213, Thermo Fisher; 1:1000), KAT5 (12058S, Cell Signaling Technology; 1:1000), H4K8ac (07-328, Millipore; 1:1000), H4K12ac (61527, Active Motif; 1:1000), histone H4 (ab177840, Abcam; 1:1000), GAPDH (2118S, Cell Signaling Technology; 1:5000), flagtag (F7425, Millipore; 1:5000), and V5-tag (13202S, Cell Signaling Technology; 1:1000).

Techniques: Activity Assay, Expressing, Competitive Binding Assay, Transduction, Western Blot, Co-Immunoprecipitation Assay, ChIP-sequencing, ChIP-qPCR, Quantitative RT-PCR

Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

Article Title: Epigenetic Control of Translation Checkpoint and Tumor Progression via RUVBL1-EEF1A1 Axis.

doi: 10.1002/advs.202206584

Figure Lengend Snippet: Figure 5. Lysine 108 in RUVBL1 is required for the interaction between RUVBL1 and MYC. A) Schematic outline of RUVBL1 high-density CRISPR gene body scan in A673-Cas9 cells. B) 2D annotation of RUVBL1 CRISPR scan. The gray line indicates the smoothened model of the CRISPR scan score derived from 194 sgRNAs (dots) targeting the coding exons of RUVBL1 (n = 3 replicates). The median CRISPR scan scores of the positive control (red line; defined as −1.0) and negative control (blue line; defined as 0.0) sgRNAs are highlighted. C) 3D annotation RUVBL1 CRISPR scan score relative to a cryo-EM structural model of a hexamer consists of three RUVBL1 and three RUVBL2 proteins (PDB ID: 5OAF). D) Western blot showing doxycycline (DOX)-induced expression of flag-tagged WT- and K108A-RUVBL1 in A673-dCas9-KRAB cells. E) Effect of WT- and K108A-RUVBL1 expression on the growth competition assay of A673-dCas9-KRAB cells transduced with sgiCtrl and sgiRUVBL1 (n = 3 for each group). F) Western blot of RUVBL1, H4K8ac, H4K12ac, EEF1A1, histone H4, and GAPDH in WT- and K108A-RUVBL1 expressing A673-dCas9-KRAB cells transduced with sgiCtrl and sgiRUVBL1. G) Co-IP of WT- and K108A-RUVBL1 (flag-tagged) with RUVBL2, KAT5, and MYC in HEK293 cells. H) Model of RUVBL1 supporting MYC chromatin binding and target gene expression. Data are represented as mean ± SEM. *P < 0.01 compared to sgCtrl by two-sided Student’s t-test. Source data are available for this figure: SourceData F5 B.

Article Snippet: PVDF membranes were immersed in 5% nonfat milk then incubated at 4 °C overnight with primary antibodies against RUVBL1 (HPA019947, Sigma; 1:1000), RUVBL2 (12668S, Cell Signaling Technology; 1:1000), MYC (13987S, Cell Signaling Technology; 1:1000), EEF1A1 (PA5-17213, Thermo Fisher; 1:1000), KAT5 (12058S, Cell Signaling Technology; 1:1000), H4K8ac (07-328, Millipore; 1:1000), H4K12ac (61527, Active Motif; 1:1000), histone H4 (ab177840, Abcam; 1:1000), GAPDH (2118S, Cell Signaling Technology; 1:5000), flagtag (F7425, Millipore; 1:5000), and V5-tag (13202S, Cell Signaling Technology; 1:1000).

Techniques: CRISPR, Derivative Assay, Positive Control, Negative Control, Cryo-EM Sample Prep, Western Blot, Expressing, Competitive Binding Assay, Transduction, Co-Immunoprecipitation Assay, Binding Assay, Targeted Gene Expression

Journal: iScience

Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

doi: 10.1016/j.isci.2023.106428

Figure Lengend Snippet: Key resources table

Article Snippet: Incubate at 4°C for 30 min. Cleared lysate was then incubated with normal immunoglobulin G (IgG) and anti-reptin (Cell Signaling Technology, #12668)) primary antibodies together with 15 μL pre-washed Protein A beads at 4 °C overnight.

Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software

Journal: iScience

Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

doi: 10.1016/j.isci.2023.106428

Figure Lengend Snippet: Key resources table

Article Snippet: Incubate at 4°C for 30 min. Cleared lysate was then incubated with normal immunoglobulin G (IgG) and anti-reptin (Cell Signaling Technology, #12668)) primary antibodies together with 15 μL pre-washed Protein A beads at 4 °C overnight.

Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software

Journal: iScience

Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

doi: 10.1016/j.isci.2023.106428

Figure Lengend Snippet: Key resources table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-reptin Cell Signaling Technology Cat#12668S; RRID: AB_2797987 Rabbit monoclonal anti-IgG Cell Signaling Technology Cat#14708S; RRID: AB_2798581 Rabbit monoclonal anti-APPL1 Cell Signaling Technology Cat#3858S; RRID: AB_2056989 Rabbit monoclonal anti-Histone 2A Cell Signaling Technology Cat#7631S; RRID: AB_10860771 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Cat#5174S; RRID: AB_10622025 Rabbit monoclonal anti-β-catenin Cell Signaling Technology Cat#8480S; RRID: AB_11127855 Rabbit monoclonal anti-Non-β-catenin Cell Signaling Technology Cat#8814S; RRID: AB_11127203 NF-κB Pathway Antibody Sampler Kit Cell Signaling Technology Cat#9936T; RRID: AB_561197 Rabbit monoclonal anti-CD44 Cell Signaling Technology Cat#37259S; RRID: AB_2750879 Rabbit monoclonal anti-ICAM-1 Cell Signaling Technology Cat#67836S; RRID: AB_2799738 Biological samples Serum of Healthy control subjects and Diabetes patients Anzhen Hospital, Capital Medical University, Beijing, China https://anzhen.org/ Chemicals, peptides, and recombinant proteins Recombinant Human gAcrp30/Adipolean Peprotech.inc CAS:25-450-21 Recombinant CD44 protein ®Sangon Biotech CAS:D622619 Critical commercial assays BCA Protein Array Kit Thermo Fisher Scientific, Inc. CAS:23227 Qproteome Cell Compartment Kit CAS:37502 The Transcription Factor Activation Profiling Plate Array II Signosis, Sunnyvale, CA CAS: FA-1002 RT2 ProfilerTM PCR Array Human Transcription Factors Qiagen, USA GeneGlobe ID-PAHS-075ZA-24; CAS: 330231 ELISA Kit for Adiponectin (ADPN) Cloud-Clone Corp CAS: SEA605Hu ELISA Kit for CD44 Cloud-Clone Corp CAS: SEA670Hu EZ-Link Sulfo-NHS-LC-Biotinylation kit Thermo Fisher Scientific, Inc. CAS:21435 Deposited data Raw and analyzed data This paper GEO: GSE217607 Experimental models: Cell lines Human umbilical vein endothelial cells (HUVECs): 4201HUM-CCTCC00635 NICR http://cellresource.cn/fdetail.aspx?id=5307/ Experimental models: Organisms/strains Mouse: APPL1 −/− , 8 weeks’s old BRL Medicine Inc. N/A Mouse: APN −/− , 8 weeks’s old Gift N/A Oligonucleotides siRNA targeting sequence: APPL1 #1: UCUCACCUGACUUCGAAACU This paper N/A siRNA targeting sequence: CD44 #1: GAACAAGGAGUCGUCAGAAACUCCA This paper N/A Primers, see Table S2 This paper N/A Software and algorithms GraphPad Prism 8.0 GraphPad Software Inc., San Diego, CA https://www.graphpad.com/ SPSS Statistics 25.0 SPSS Inc., Chicago, IL https://www.ibm.com/ Open in a separate window Key resources table .

Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software

Journal: iScience

Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

doi: 10.1016/j.isci.2023.106428

Figure Lengend Snippet: Key resources table

Article Snippet: Rabbit monoclonal anti-reptin , Cell Signaling Technology , Cat#12668S; RRID: AB_2797987.

Techniques: Control, Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software